Osteoporosis and its Association with Estrogen Receptor- alpha Gene Polymorphism in a population of Iranian Women Referring to Loghman Hospital

This Article

Citations


Article Information:


Group: 2009
Subgroup: Volume 7, Issue 3, Summer
Date: September 2009
Type: Original Article
Start Page: 193
End Page: 199

Authors:

  • F Pouresmaeili
  • Genetics Department, and Fertility-Infertility Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran
  • A Roohi
  • Genetics Department, and Fertility-Infertility Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran
  • M J Tehrani
  • Immunology and Genetics Department of Avicenna Research Center Shahid Beheshti University of MedicalSciences, Tehran, IR.Iran
  • E Azargashb
  • Department of Social Medicine Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran
  • B Kazemi
  • Molecular Biology Research Center, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran
  • H S Tehrani
  • Genetics Department, and Fertility-Infertility Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran
  • F SalehiNiya
  • Genetics Department, and Fertility-Infertility Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran

      Correspondence:

      Affiliation: Genetics Department, and Fertility-Infertility Health Research Center (IRHRC), Faculty of Medicine, Shahid Beheshti University of Medical Sciences
      City, Province: Tehran,
      Country: IR.Iran
      Tel:
      Fax:
      E-mail: fpoures@yahoo.com

Abstract:


Osteoporosis is a common disease in which the bones become prone to fracture as a result of loss of bone mineral density (BMD). The estrogen receptor (ER) gene is a candidate gene for os-teoporosis. This study assesses the relation be-tween estrogen receptor-α gene polymorphism and osteoporosis in a population of Iranian women. Materials & Methods: In the present study, we investigated 200 pre- and/or post-menopausal Iranian women, aged 35-80 years, stratified for BMD into normal and patient groups. The genomic DNA of both groups was amplified by PCR using specific primers and products were digested by restriction enzymes PvuII or XbaI to identify the related genotypes. The genotypes of intron 1 PvuII or XbaI poly-morphisms of the ER-α gene were detected and introduced so that the upper case and lower case letters of Pp (PvuII) and Xx (XbaI) signified the absence or presence of restriction sites in RFLP experiments. Results: Based on our results, no significant relationship was observed between BMD and intron 1 RFLPs of the estrogen recep-tor alpha gene. Three genotypes, Pp XX, pp XX and PP xx, were detected, all at a very low fre-quency in this population of Iranian women. Conclusion: To conclude no significant relation-ship was found between BMD and intron 1 RFLPs of the estrogen receptor alpha gene. Larg-er numbers of patients need to be investigated to ascertain and confirm whether ER-α genotypes are associated to the disease etiology and if any other factors are involved.

Keywords: Osteoporosis;Estrogen receptorgene;Polymorphism;Menopause;PvuII;XbaI

Manuscript Body:


 

Introduction

Osteoporosis is increasingly considered as a major public health problem in the aging populations of most countries worldwide. Bone mineral density (BMD), the main determinant of osteoporosis fracture risk,1 besides being affected by the environment, is strongly influenced by genetic factors,2 first reported in the association shown between BMD and vitamin D receptor (VDR) gene polymorphism.3 However, there is still disagre-ement whether the VDR polymorphisms are definitely responsible for loss of BMD.4 On the other hand, estrogen and its receptors play an important role in controlling skeletal growth and maintenance of bone mass,5 and estrogen therapy has been shown to prevent bone mineral loss.6 Moreover, inactivation of the ER-α  gene is associated with low BMD, indicating that this gene is  a strong candidate for osteoporosis. ER-α belongs to the nuclear receptor super family of ligand-inducible transcription factors7 and it is also implicated in the development or progression of numerous diseases, which include but are not limited to various types of cancer.8 ER-α gene, located at 6q25.1, is greater than 140 kb in length and splits into eight exons and seven introns. Several polymorphic sites within the ER-α gene locus have been revealed by genetic screening9,10 of  which the most widely studied are TA dinucleotide repeat polymorphism at the 5’ upstream of exon 1 and PvuII and XbaI  RFLPs of the intron 1. Although many publications have demonstra-ted the relationship between ER-α polymor-phisms and BMD in different populations,11-14 their association varies across different count-ries.15 The TGF β116 androgen receptor,17 IGF 1 gene,18 Interleukin-1 receptor antagonist,19 Interleukin-6,20 and the collagen type I alpha 1 gene (COLIA1),4,21 are among nearly sixty candidate genes discovered so far that have been implicated as determinants of bone mass. The conflicting results might be due to different genetics and environmental back-ground such as diet, exercise and drugs in different cohorts.11 Clarification of the role of these genes will eventually lead to more advanced diagnostic methods and availability of more efficacious drugs targeting osteo-porosis.22 In the current study, our goal was to examine the role of intron 1 PvuII and XbaI polymorphisms of the ER-α gene in a population of pre- and/or post-menopausal Iranian women, stratified for BMD into normal and patient groups.

Materials and Methods

Subjects: Unrelated women, referred for acute skeletal pain to the rheumatology clinic and the BMD department of Loghman Hospital in Tehran, Iran, underwent dual energy x-ray absorptiometry (DXA); of these, 100 were randomly selected as controls and 100 as cases according to their BMD values. A detailed profile including medical, personal and family history was obtained from all subjects, aged 35-80 years, and any women with a history of using hormonal drugs, calcium tablets or having any dietary habits that would affect bone mass and turnover, were excluded from analysis.

Measurement: For each subject, BMD (g/cm2) was measured at lumbar spine (L1-4), femoral neck, the trochanter and ward triangle by dual-energy X-ray abrop-tiomerty (DXA; Lunar DPX-L densitometer, Lunar Corp., Madison, WI).

Genotyping: Genomic DNA was extracted and purified from EDTA blood samples (of each volunteer) using the method of Miller et al. 1988 23. Genotypic analysis of ER-alpha PvuII, and XbaI gene polymorphisms was done by polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP). The primers were designed to amplify a part of intron 1 and exon 2 of the ER gene. PvuII and XbaI polymorphisms are 45 bp apart and located approximately 400 bp upstream of exon 2.

PCR: Amplification of a 527 bp PCR fragment was performed using 0.1 µg of extracted DNA in 50 µl of buffer solution [1X PCR buffer (Cinnagen, Karaj, Iran), 1.5 mM MgCl2, 100 µM dNTP mix and 39.3 µl DDW] with 1 U of Taq. DNA polymerase (Cinnagen, Karaj, Iran) and 100 nM of each Oligonucleotide primer (Forward primer:

 5'ATCCAGGGTTATGTGGCAATGAC3',

Reverse primer:

5'ACCCTGGCGTCGATTATCTGA3'). PCR was performed for 40 cycles with the following steps: Denaturizing at 94°C for 30s, annealing at 59°C for 40s and elongation at 72°C for 1 minutes and a final extension of 2 minutes at 72°C.

Figure 1. Amplification of ER-alpha gene fragment.

 

Figure 2. Restriction digest of PCR product.

Restriction digest

For amplification, samples of 50 μl containing 1x PCR buffer, 1.5 mM MgCL2, 100 mM dNTP Mix, 100 nM each primer, 1 unit of Taq DNA polymerase, 0.1 μg genomic DNA were subjected to 40 cycles of amplification. Each sample was resolved on a 2% agarose gel containing ethidium bromide. The length of the product is 527 bp (lane 2-7). The marker was 100bp DNA ladder (lane 1).

After amplification, the PCR products (fig.1) were digested with 2 IU of either PvuII or XbaI restriction enzymes (New England Biolabs, Ipswich, MA , USA) and resolved on 2.0% agarose gels with ethidium bromide staining (figure 2). The genotypes were represented as Pp (PvuII) and Xx (XbaI), with upper case and lower case letters signifying the absence and presence of the restriction site, respectively.RFLP was performed for each sample separately. Two set of reactions of 30 μl were prepared. Each reaction contained 1x NE buffer, 2 units PvuII or XbaI, 4-6 ng/ μl PCR product, 1X BSA for XbaI digestion reaction.Samples were analyzed on 2% agarose gel. Lane 1 and 6: 100 bp DNA ladder, PvuII digestion results: Lines 2-5, XbaI digestion products: lines 7-10 (figure 2).

 

Statistical analysis

 All statistical analyses were carried out using the SPSS software package (SPSS 10.0.0, Chicago, IL, USA).

Changes in BMD were analyzed by non-paired T-scores and Z- scores. Genotype frequencies of controls and patients were compared using the Pearson, Chi-square and Fischer exact tests. A p-value of less than

0.05 was considered statistically significant.

Results

The frequencies of the ER-α genotypes were almost similar to previously published genotype frequencies in European and East-Asian populations.

Table 1. Comparison of spine and femur bonemass density mean value in the case and control groups according Z and T scores

Groups (Mean±SD)
SP.Z  
 Control 0.411±1.0*
 Case -1.296±843
SP.T  
 Control 0.285±1.1
 Case -1.959±0.887
SP.BMD  
 Control 1103.33±124.281
 Case 846.46±100.483
FEM.Z  
 Control 0.741±0.919
 Case 0.393±0.873
FEM.T  
 Control 0.700±1.146
 Case -0.862±1.02
FEM.BMD  
 Control 967.26±112.713
 Case 797.53±119.27

SP.Z: SpineZ-score,SP.T: SpineT-score, SP.BMD: Spine bone mass density, FEM.Z:FemurZ-score,FEM.T: FemurT-score, FEM. BMD=Femur bone mass density,

* P<0.001

The study subjects were unrelated and aged 37-70 years with an average spine BMD of 1.296 (Z-score) and -1.959 (T-score), respectively (Table 1). As it is shown in this table, the mean of spine BMD in control group was 0.41 by Z-score and 0.285 with T-score. The difference between the two groups in spine BMD according to T-scores and Z-scores was significant (p≤0.0001). The ER-alpha genotypes were obtained by PCR (Fig.1) followed by restriction enzyme PVUII and XbaI digestion (Fig. 2).Interestingly, while the control group showed no osteoporosis of the spine area (Tscore≤-2.5), 25% of the patients showed osteoporosis with the same evaluation (Table 2), indicating a significant difference in the percentage of osteoporosis (p<0.0001).Although no significant difference was found between the two groups in the femoral neck (p≤1, Z-score with Fisher exact test), there was a significant difference in the lumbar spine region (p≤ .007, Z-score with Fisher’s exact test), Table 2. After performing PCR-RFLP, the two groups showed no sig-nificant difference regarding their P geno-types, PP, Pp, pp, (p=.471) or X genotypes, XX, Xx, xx, (p=.6), Table 2. Moreover, the spine T-score shows that 12.5% of the 200 people under study were osteoporotic, whereas considering the femoral neck T-score, only 3% of the 200 individuals were osteoporotic. Based on the Z-score, only 4% were osteoporotic in the spine and 5% were osteoporotic in the femoral neck region, respectively.

 

Table 2. Comparison between P and X genotype frequency of case and control groups, comparing
the T and Z- scores for spine and femur of both groups

Groups   Control
Numbers (%)
Case
Numbers (%)
P-Genotype      
 PP    17 (17%)  21(21%)
 PP    51(51%)  53(53%)
 PP    32(32%)  26(26%)
X-Genotype      
 XX
   14(14%)  18(18%)
 XX    76(76%)  70(70%)
 XX    10(10%)  12(12%)
P-X-Genotype      
 P- X    68(68%)  74(74%)
 Ppxx,ppXx, ppxx    32(32%)  26(26%)
Tscore for      
 Spine (+)  0  25
 Osteoporosis (-)  100  75
Tscore for      
 Femur (+) 0
 6
 Osteoporosis (-)  100  94
Zscore for      
 Spine (+)  0  8
 Osteoporosis (-)  100  92
Zscore for      
 Femur (+)  0  1
 Osteoporosis (-)  100  99

 

Discussion

In this national cross-sectional survey, we found that Georgia meets the primary criteria for sustainable elimination of IDD (i.e., more than 90% of households using adequately iodized salt and <50% of population with UIE<100 μg/L).4 In less than 10 years, house-hold consumption of adequately iodized salt has increased 10-fold, and the population with adequate iodine nutrition has increased 18-fold (Figure 2). Rates of goiter have also trended downward, as prevalence was 39% in 2003 and 32% in 2005 (based on palpation in the present survey). Figure 2. Results of efforts to eliminate iodine deficiency disorders in Georgia, 1998-2005. Before the 2005 legislation on the iodization of salt, WHO targets were not reached in Georgia even with a strong IDD program and national standards for salt iodization. The remarkable and rapid achie-vement of eliminating ID in this country is likely due to legislation mandating the iodiz-ation of salt and effective implementation of such iodization. Fortification laws give the government authority to mandate com-pliance with food standards and become advocacy tools that demonstrate the govern-ment’s commitment to combating micro-nutrient malnutrition.13 Important policy decisions were made in Georgia before the 2005 introduction of the law on iodizing salt that may help explain its rapid success in eliminating IDD. For instance, a strong regulatory structure was in place, and the government has been willing and able to enforce legislation on the iodization of salt. The chair of the Georgian National Fortification Alliance is also an influential member of parliament who regu-lates enforcement mechanisms. At the import level, all salt must pass through one of three major ports where the Customs Department provides a certificate of authenticity that the salt is iodized.7 Legislation is also enforced at the wholesale and retail level by the Ministry of Agriculture, which monitors the distribution, storage, and labeling of salt for household consumption. The strong partner-ship between the government of Georgia, the salt industry, and UNICEF also makes acc-ountability and enforcement of food forti-fication multisectoral. Although legislation mandating the iodi-zation of salt is an important early step, additional programmatic factors are important to sustain the elimination of IDD.4 Some of these factors that are im-portant for Georgia to endorse include ongoing political commit-ment to the elimination of IDD, having access to laboratories that provide accurate results on the concentration of iodine in salt and urine, a public education program, cooperation from the salt industry in maintaining quality control, and an ongoing monitoring and evaluation system. The median UIE of greater than 300 ug/L that we found in school-aged children is likely explained by the fact that in Georgia the iodization of salt is truly universal. All salt, including salt for animal consumption, household salt, and salt used in the food industry, is iodized. Another factor to consider is that the patterns of food consumption among children (e.g., intake of bread) may differ from those of adults (children probably eat more bread), which may partly explain the more than adequate iodine nutrition status in our study group. Correspondingly, school-aged children may not be the best target group to assess the impact of continued efforts to ensure adequate iodine nutrition in Georgia, and other vulnerable groups, such as women of childbearing age, should be included in future surveys. Furthermore, a nationally representative cluster sample may not rule out pockets of iodine deficiency in certain regions of the country where consumption of iodized salt remains low. A valid assessment of iodine nutrition is important because excessive iodine intake (defined by WHO/UNICEF/ICCIDD as a median UIE > 300 ug/L) may lead to adverse effects, including subclinical hypothyroidism and autoimmune thyroiditis.14 To prevent excess intake, the iodine content of salt can be adjusted, and the iodine levels in foods, such as dairy products and bread, may need to be regulated. Because programs for iodizing salt do not always have an immediate impact on the prevalence of goiter, we were not surprised to find a goiter prevalence of 32% in the studied population in the presence of adequate iodine nutritional status. For example, in South Africa the prevalence of goiter in children did not decline after 12 months of mandatory salt iodization, even though their urinary iodine concentration improved.15 The persis-tence of goiter in school-aged children in Georgia likely reflects longstanding iodine deficiency, and it is known that enlarged thyroids in children who are iodine deficient at a young age may not regress completely after introduction of iodized salt.16 During the early phase of a salt iodization program, goiter prevalence is a poor indicator because it reflects a population’s history of iodine nutrition but not its present iodine status.17 A limitation of the present study was that the prevalence of goiter was estimated by thyroid palpation. In areas with mild-to-moderate IDD, both the sensitivity and specificity of palpation are poor, and measurement of thyroid volume by ultrasound is preferable.18 It is important to note that measurement of goiter may not be appropriate in short-term evaluations of the effectiveness of salt iodization programs. In conclusion, our findings highlight that legislation mandating the iodization of salt and effective implementation can lead to increased consumption of iodized salt and elimination of IDD. Targeted evaluations of iodine status of high-risk groups, including women of childbearing age, pregnant and lactating women, and infants, need to be performed. In addition, potential excessive iodine intake in certain populations warrants further investigation and correction. Despite the apparent success of Georgia’s salt iodization program, legislation needs to be enforced, and an effective monitoring and evaluation system needs to be introduced at all levels of the iodized salt supply to sustain the elimination of IDD.

Acknowledgments

This research was supported by the UNICEF CEE/CIS regional office. We thank Giorgi Gegela-shvili and the Georgia National Fortification Alliance for their commitment to USI in Georgia, Frits van der Haar and Kevin Sullivan from Emory University for their technical assistance, Arnold Timmer and Giovanna Barberis from UNICEF for their guidance, and all the children and their families who participated in this survey.

References: (36)

  1. Kanis JA, Melton LJ, Christiansen C, Johnston CC, Khaltaev N. The diagnosis of osteoporosis. J Bone Miner Res 1994; 9: 1137-41.
  2. Richards JB, Rivadeneira F, Inouye M, Pastinen TM, Soranzo N, Wilson SG, et al. Bone mineral density, osteoporosis, and osteoporotic fractures: a genome-wide association study. Lancet 2008; 371: 1505-12.
  3. Dundar U, Solak M, Kavuncu V, Ozdemir M,Cakir T, Yildiz H, et al. Evidence of association of Vitamin D receptor Apa I gene polymorphism with bone mineral density inpostmenopausal women with osteoporosis.Clin Rheumatol 2009; 28: 1187-91.
  4. Uitterlinden AG, Ralston SH, Brandi ML,Carey AH, Grinberg D, Langdahl BL, et al.The association between common vitamin Dreceptor gene variations and osteoporosis: aparticipant-level meta-analysis. Ann InternMed 2006; 145: 255-64.
  5. Tranah GJ, Taylor BC, Lui LY, Zmuda JM,Cauley JA, Ensrud KE, et al. Genetic variationin candidate osteoporosis genes, bonemineral density, and fracture risk: the studyof osteoporotic fractures. Study of OsteoporoticFractures (SOF) Research Group. CalcifTissue Int 2008; 83: 155-66.
  6. Lindsay R, Hart DM, Purdie D, FergusonMM, Clark AS, Kraszewski A. Comparativeeffects of estrogen and progesterone on boneloss in postmenopausal women. Clin Sci MolMed 1978; 54:193-5.
  7. Achari Y, Lu T, Hart DA. Polymorphisms inthe promoter regions for human MMP-1 andMMP-13 lead to differential responses to thealpha and beta isoforms of estrogen receptorand their ligand in vitro.Biochim BiophysActa 2008; 1782: 391-400.
  8. Deroo BJ, Korach KS. Estrogen receptorsand human disease. Clin Invest 2006; 116:561-70.
  9. Castagnoli A, Maestri I, Bernardi F, Del sennoL. PvuII RFLP inside the human estrogenreceptor gene. Nucleic Acids Res 1987; 15:866.
  10. Kastelan D, Grubic Z, Kraljevic I, Polasek O,Dusek T, Stingl K, et al. The role of estrogenreceptor-alpha gene TA polymorphism andaromatase gene TTTA polymorphism onpeak bone mass attainment in males: is therean additive negative effect of certain allelecombinations? J Bone Miner Metab 2009;27: 198-204.
  11. Kobayashi N, Fujino T, Shirogane T, FurutaI, Kobamatsu Y, Yaegashi M, et al. Estrogenreceptor alpha polymorphism as a geneticmarker for bone loss, vertebral fractures andsusceptibility to estrogen. Maturitas 2002; 41:193-201.
  12. Lau EM, Young RP, Lam V, Li M, Woo J.Estrogen receptor gene polymorphism andbone mineral density in postmenopausal Chinesewomen. Bone 2001; 29: 96-8.
  13. Han KO, Moon IG, Kang YS, Chung HY,Min HK, Han IK. Non-association of estrogenreceptor genotypes with bone mineraldensity and estrogen responsiveness to hormonereplacement therapy in Korean postmenopausalwomen. J. Clin Endocrinol Metab1997; 82: 991-5.
  14. Aerssens J, Dequeker J, Peeters J, BreemansS, Broos P, Boonen S. Polymorphisms of theVDR, ER and COLIA1 genes and osteoporotichip fracture in elderly postmenopausalwomen. Osteoporos Int 2000; 11: 583-91.
  15. Ralston SH. Genetic determinants of osteoporosis.Curr Opin Rheumatol 2005; 17: 475-9.
  16. Langdahl BL, Uitterlinden AG, Ralston SH,Trikalinos TA, Balcells S, Brandi ML, et al;GENOMOS Study. Large-scale analysis ofassociation between polymorphisms in thetransforming growth factor beta 1 gene(TGFB1) and osteoporosis: the GENOMOSstudy. Bone 2008; 42:969-81.
  17. Sowers M, Willing M, Burns T, Deschenes S,Hollis B, Crutchfield M, et al. Genetic markers,bone mineral density and serum osteocalcinlevels. J Bone Miner Res 1999; 14:1411-9.
  18. Rosen CJ, Kurland ES, Vereault D, AdlerRA, Rackoff PJ, Crai, et al. Association Be tween Serum Insulin Growth Factor-I (IGF-I)and a Simple Sequence Repeat in IGF-I Gene: Implications for Genetic Studies ofBone Mineral Density. J Clin Endocrinol Metab 1998; 83: 2286-90.
  19. Keen RW, Woodford-Richens KL, Lanchbury JS, Spector TD. Allelic variation at the interleukin-1 receptor antagonist gene is associated with early postmenopausal boneloss at the spine. Bone 1998; 23: 367-71.
  20. Tsukamoto K, Ohta N, Shirai Y, Emi M. Ahighly polymorphic CA repeat marker at thehuman interleukin 6 receptor (IL6R) locus. JHum Genet 1998; 43: 289-90.
  21. Lindahl K, Rubin CJ, Brändström H,Karlsson MK, Holmberg A, Ohlsson C, et al.Heterozygosity for a coding SNP in COL1A2confers a lower BMD and an increased strokerisk. Biochem Biophys Res Commun. 2009;384: 501-5.
  22. Niu T, Xu X. Candidate genes for osteoporosis.Therapeutic implications. Am J Pharmacogenomics2001; 1: 11-19.
  23. Miller SA, Dykes DD, Polesky HF. A simplesalting out procedure for extracting DNAfrom human nucleated cells. Nucleic AcidsRes 1988; 16: 1215.
  24. Ioannidis JP, Ralston SH, Bennett ST, BrandiML, Grinberg D, Karassa FB, et al.GENOMOS Study. Differential Genetic Effectsof ESR1 Gene Polymorphisms on OsteoporosisOutcomes. JAMA 2004; 292:2105-14.
  25. Rizzoli R, Bonjour JP, Ferrari SL. Osteoporosis,genetics and hormones. J Molec Endocrinol2001; 26: 79-94.
  26. Jakimiuk A, Nowicka M, Bogusiewicz M,Adamiak A, Skorupski P, Miotla P, et al.Prevalence of estrogen receptor PvuII andXbaI polymorphism in population of Polishpostmenopausal women. Folia HistochemCytobiol 2007; 45: 331-8.
  27. Ivanova JT, Doukova PB, Boyanov MA, PopivanovPR. PvuII and XbaI polymorphismsof the estrogen receptor gene and bone mineraldensity in a Bulgarian population sample.Hormones 2007; 6: 36-43.
  28. Van Meurs JB, Schuit SC, Weel AE, Van derKlift M, Bergink AP, Arp PP, et al. Associationof 5' estrogen receptor alpha gene polymorphismswith bone mineral density, vertebralbone area and fracture risk. Hum MolGenet 2003; 12:1745-54.
  29. Becherini L, Gennari L, Masi L, Mansani R,Massart F, Morelli, A, et al. Evidence of alinkage disequilibrium between polymorphismsin the human estrogen receptor alphagene and their relationship to bone mass variationin postmenopausal Italian women. HumMol Genet 2000; 9: 2043-50.
  30. Albagha OM, Pettersson U, Stewart A, McGuigan FE, Mac Donald HM, Reid DM, et al.Association of oestrogen receptor alpha genepolymorphisms with postmenopausal boneloss, bone mass, and quantitative ultrasoundproperties of bone. J Med Genet 2005; 42:240-6.
  31. Langdahl BL, Lokke E, Carstens M, StenkjaerLL, Eriksen EF. A TA repeat polymorphismin the estrogen receptor gene is associatedwith osteoporotic fractures but polymorphismsin the first exon and intron arenot. J Bone Miner Res 2000; 15: 2222-30.
  32. Qin YJ, Zhang ZL, Huang QR, He JM, HuYQ, Zhao Q, et al. Association of vitamin Dreceptor and estrogen receptor-alpha gene polymorphismwith peak bone mass and bonesize in Chinese women. Acta Pharmacol Sin2004; 25:462-8.
  33. Siminoski K, Leslie WD, Frame H, HodsmanA, Josse RG, Khan A, et al. Recommendationsfor bone mineral density reporting inCanada: a shift to absolute fracture risk assessment.J Clin Densitom 2007; 10: 120-3.
  34. Cooper, Mark S. Our approach to osteoporosisscreening and treatment needs to change.CMAJ 2008; 178: 1683-4.
  35. Johnson J, Wang MY. Genome search revealsgene variants associated with low bonemineral density and fractures in osteoporosis.Neurosurgery 2008; 63: N12.
  36. Melton LJ, Atkinson EJ, O’Connor MK,O’Fallon WM, Riggs BL. Determinants ofbone loss from the femoral neck in women ofdifferent ages. J Bone Miner Res 2000; 15:24-31.