Effects of Treadmill Exercise on Fundus Ghrelin Expression and Plasma Acylated Ghrelin level in Male Rats

This Article

Citations


Article Information:


Group: 2010
Subgroup: Volume 8, Issue 1, Winter
Date: January 2010
Type: Original Article
Start Page: 22
End Page: 31

Authors:

  • A Ghanbari Niaki
  • Department of Physical Education and Sport Science, University of Mazandaran, Babolsar, IR.Iran
  • R Fathi
  • Department of Physical Education and Sport Science, University of Mazandaran, Babolsar, IR.Iran
  • M Hedayati
  • Obesity Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, IR.Iran

      Correspondence:

      Affiliation: Obesity Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences
      City, Province: Tehran,
      Country: IR.Iran
      Tel:
      Fax:
      E-mail: Hedayati@endocrine.ac.ir

Abstract:


The gastric peptide ghrelin, an endogenous ligand for growth-hormone secretagogue receptor, in its acylated form induces a positive energy balance, increase in food intake and adiposity.
This study aimed at determining the effects of treadmill exercise training on fundus Ghrelin mRNA expression, fundus, and plasma acylated Ghrelin concentration in rats. Materials and Methods: Thirty-six adult Wistar male rats (12-14 weeks old, 200-220g) were randomly divided into the experimental 1 (EX1) (n=16) and experimental 2 (EX2, n=20) groups with further division into control (n=8 and 10) and training (n=8 and 10) groups. Training groups were given exercise on a motor-driven treadmill (28 m/min, 0% grade, 60 min, 5 days/week for 8 weeks). Rats in EX1 were further divided into four groups; fed-control (FEC), fed-trained (FET), fast-control (FAT) and fast-trained (FAT). Twenty-four hours after last training session, the fundus was excised and frozen in liquid nitrogen for extraction of ghrelin mRNA. Fundus and plasma acylated ghrelin, growth hormone (GH), insulin, cortisol, lipids, and glucose were also measured. Results: Ghrelin mRNA expression was significantly (P=0.002) higher in fasted rats and lower in trained-rats, in whom a non significant increase was observed in resting plasma acylated Ghrelin, GH, insulin, liver glycogen and lower free fatty acids concentrations and muscle glycogen. Plasma cortisol, triglycerides (TG), total choles-Correspondence: Mehdi Hedayati, Obesity Research Center, Research Institute for Endocrine Sciences, Shahid Beheshti University of Medical Sciences, Tehran, Iran E-mail: Hedayati@endocrine.ac.irterol (TC) was remained unchanged. Interestingly, fundus acylated ghrelin was significantly (P=0.031) lower in trained rats. Conclusion: The data obtained showed that treadmill exercise reduced ghrelin expression and its acylated levels in the fundus of trained rats and a higher plasma acylated ghrelin could be released from other source (s).

Keywords: Fundus;acylated Ghrelin;mRNA expression;Treadmill exercise

Manuscript Body:


Introduction

Ghrelin, a 28-amino acid peptide recently isolated from the human and rat stomach, is also present in human and rat pancreatic alpha-cells1, 2. It is also recognized as a novel player in the gut-brain regulation of growth hormone and energy balance3. The molecule has been shown to be a growth hormone (GH) secretagogue that stimulates an increase in blood glucose4,5. Ghrelin has a potent effect on eating behavior, causing an increase in hunger2 and plays a key role in the central regulation of feeding6. It has been suggested that the stomach is a major source of circulating ghrelin in humans7. Interestingly, ghrelin levels are significantly altered during acute and chronic aberration in nutritional status. Thus ghrelin levels are low in simple obesity but increase after weight loss8,9. Ghrelin is up-regulated by fasting, insulin-induced hypoglycemia and leptin administration10,11. Plasma Ghrelin response to different kind of physical exercise has been studied by several investigators in human12,13, horse14,15, and rat subjects16,17. The results are conflicting, several studies documenting no change in plasma ghrelin concentration, while others observed suppressed levels. To date, most investigations have focused on plasma ghrelin response to an acute exercise (shortterm, or long-term, resistance or aerobic exercise). Foster-Schubert et al studied the effect of an aerobic exercise for 12 months on 173 sedentary, overweight, postmenopausal women, and reported that plasma ghrelin increases by 18% in exercisers who lost over 3 kg of weight13. Ebal et al17 studied the effect of 5 weeks of a force-resistance exercise on plasma ghrelin concentration in rats, and suggested that training reduced the rats’ body weight by 6.4% and lowered ghrelin levels. Recent evidence suggests that skeletal muscle is an important site of ghrelin action. Ghrelin and growth hormone secretagogue receptor (GHS-R) have been found in skeletal muscle18 and it has been shown that growth hormone secretagogue can alter both electrical and contractile activity in skeletal muscle19. Moreover, GHS receptors have been localized in skeletal muscle20. Collectively, these studies suggest that the fundus as well as skeletal muscle is important sites of ghrelin action.
Treadmill running speeds have been used previously to elicit the respective moderate VO2 max values (%) for Wistar rats21 and previous data from our lab suggest that training, 25m/min, 60 min/day, 5days/week for 6 weeks affected total ghrelin levels in rat soleus muscle22; Hence we utilized a reasonable training time period to produce the expected acylated ghrelin adaptations. However, there is no information about the effects of treadmill exercise (8 weeks) at moderate intensity (28 m/min, 0% grade) on fundus ghrelin expression, fundus and plasma ghrelin concentration in wild type male rats. This study was therefore conducted to determine the effect of treadmill exercise on resting fundus ghrelin expression, fundus plasma ghrelin concentrations and glucoregulatory hormones.  

Materials and Methods

Animal experiments 

All experiments involving the animals were conducted according to the policy of the “Iranian Convention for the Protection of Vertebrate Animals Used for Experimental and other Scientific Purposes,” and the protocol was approved by the Ethics Committee of the School of Medical Sciences, Tarbiat Modares University (TMU), Tehran Iran. Thirty-six Wistar male rats (12-14 weeks old) weighing 200-220 grams were used for this study. Animals were obtained from the Pasteur Institute (Tehran, Iran) and maintained in the Central Animal House of the School of Medical Sciences, TMU. The animals were housed five per cage; light was controlled on a 12:12-h light-dark cycle, temperature was 22.0±1.4°C and humidity was 55.6±4.0%. Animals were fed a pellet rodent diet ad libitum and had free access to water. Strewment was changed every 4 days, and the same person handled the rats throughout the study. Animals were randomly assigned into the EX1 (the first experimental, n=16) and EX2 (the second experimental, n=20) groups. All experimental animals were also randomly divided into control group, which remained sedentary (Con), while the training group (TR) underwent a moderate running exercise program. The day before the experiment, animals in EX1 group were randomly further divided into 4 groups; fed-control (FEC), fed-trained (FET), fast-control (FAC), and fast-trained (FAT), 4 animals in each. Rats were fasted overnight (at least 8 hours), with free access to water. All Animals in EX2 group were treated similar to the EX1 group, except for further division.

Exercise training protocol

Treadmill training began with familiarization of rats with the apparatus for 4 days by placing them on the motorized driven treadmill (Iranian Model, designed by, Physical Education & Sports Sciences Department of TMU, and Tehran, Iran). Training group was given exercise training for 5 days/week for 8 weeks as described previously23,24. In the first week, rats were exercised on the treadmill at a speed of 10 m/min, angle of inclination 0% gradient and the running time was 15 min/day. In the second week the speed was increased to 24 m/min, with 0% gradient and the duration to 45 min/day. In the third week, the speed was increased to 28 m/min, with 0% gradient, while the duration remained at 45 min/day. In the fourth week, the speed remained 28 m/min, with 0% gradient and the duration increased to 60 min/day. In the last 4 weeks the speed and duration remained constant. This condition corresponded to a moderate intensity of about of 65%-70% of maximal oxygen consumption23. The animals were not exercised for 24 h prior to sacrifice.

For biopsies and blood sampling, twenty-four hours after the last training session (8th week), rats were anesthetized intraperitoneally with a mixture of Ketamine TM (30-50 mg/kg body wt, ip ) and Xylazine (35mg/kg body wt, ip), and the fundus part of stomach, liver, and the entiregastrocnemius muscle were excised, each divided into two pieces and washed in ice-cold saline, and immediately frozen in liquid nitrogen for extraction of ghrelin mRNA, fundus acylated ghrelin concentration, liver and gastrocnemius muscle glycogen contents. All frozen fundus, liver and muscle pieces were stored at -80°C until analyses were performed. Liquid nitrogen homogenate of the tissue (100mg/mL of Phosphate Buffer Saline) were used for biochemical analysis. Blood was collected in EDAT test tubes as anticoagulant and immediately processed for plasma preparation, during 10min centrifugation at 3000rpm. Plasma was aliquted and stored at -80C for future analysis.

Extraction of mRNA and RT-PCR quantization

The quick frozen fundus part of the stomach was powdered in a cold mortar and pestle, and approximately 50 mg was used for the isolation of RNA. Total RNA was extracted by the Guanidinium Thiocyanate method25 and mRNA purified using mRNA Isolation Kit (Roche, Germany) according to manufacturer instructions. One microgram of mRNA was used to synthesis first strand cDNA in a 20ml volume by using oligo (dT) primer in the first-strand synthesis kit (Fermentase, Germany). Relative expression level of Ghrelin mRNA in the muscle was determined using a semi quantitative PCR method. The following primers were used to amplify rat Ghrelin and Beta-actin (as an internal control) cDNA: Ghrelin-Forward: 5´- TTGAGCCCAGAGCACCAGAAA, Ghrelin -Reverse: 5´-ACT TGT TAG CTG GCG CCT CTT TG-3'. Beta-actin-Forward: 5´TCC TGT GGC ATC CAT GAA ACT-3´; B-actin-Reverse: 5´-ATC GTG CAC CGC AAA TGC TTC-3´. Ghrelin cDNA was amplified giving a 270-bp product. PCR was formed for 35 cycle of denaturation 94ºC for 30s, annealing of 58ºC for 30s and extention at 72ºC for 50s. Reactions were set up using a 2 fold serial dilution of template cDNA to assess the best dilution of template in PCR. Template cDNA was standardized by amplification of a 315-bp internal control of B-actin, a house keeping gene, a protein known to be expressed in the tissues. All the reactions were repeated a minimum of three times to ensure repeatability. All PCR products were electrophoresed on an agarose gel and bands visualized by ethidium bromide staining and quantitated by computer integrated densiometry (Kodak, CT). Levels of mRNA were expressed as a ratio of signal intensity for the B-actin gene.
 

Biochemical analyses

The samples were analyzed for plasma and fundus acylated ghrelin, glucose, GH, insulin, cortisol, triglycerides (TG) total cholesterol (TC), and free fatty acids (FFA). Plasma high density lipoprotein cholesterol (HDL) was determined by the direct immuno method (HDL-C Immuno FS, Pars Azmoun, Tehran, Iran), the intra-assay coefficient of variation and sensitivity of the method were 1.2% and 0.03mmol/L respectively. Plasma total TG was determined using the enzymatic (GPO, glycerol-3-phosphate oxidase) colorimetric method (Pars Azmoun, Tehran, Iran). The intra-assay coefficient of variation and sensitivity of the method were 2.2% and 1 mg/dL respectively. Plasma total cholesterol (TC) was determined by the enzymatic (CHOD-PAP, cholesterol oxidaseamino antipyrine) colorimetric method (Pars Azmoun, Tehran, Iran), the intra-assay coefficient of variation and sensitivity of the method being 1.9% and 0.08 mmol/L, respectively. Liver and gastrocnemius muscle glycogen were determined by a commercial kit (Glycogen Colorimetric kit, Nanjing, China) Statistics
All results are expressed as mean ±SEM. All variables were compared by unpaired t-test. Correlation was calculated using the Pearson Product Moment correlation. All statistical analyses were performed by using SPSS (Version 13). All p values <0.05 were considered significant.  

Results

Fundus ghrelin gene expression

Semi-quantitative RT-PCT technique showed in Fig.1 including the ghrelin expression in fed-control, fed-trained, fast-control, and fast-trained rats.Overall, the overnight fasted rats showed a higher and significant (P=0.03) fundus ghrelin expression (Fig.1), whereas the trained group had lower ghrelin expression when compared to the control group (Fig. 2).  

 

Fig.1. Semi-quantitative reverse-transcriptionPCR (RT-PCR) of ghrelin mRNA in fundus infed-control (FEC), fed-trained (FET), fastcontrol(FAC), and fast-trained(FAT) malerats, 4 animals per group

 

 

Fig.2. Fundus ghrelin mRNA expression in fed,fast (A), control, and trained wild type (B)male rats, N=10 animals of each. Data is expressed as mean ± SEM. * fast vs fed, P=0.002.

 

Table 1. Anthropometry, plasma glucose,hormones, and lipid profiles in control andtrained wild type male rats

Variables Control
Group
n=10
Trained
Group
n= 10
Weight (g) 345.00 ± 12.63 321.5± 8.1
Height (cm) 23.70 ± 0.25 23.43 ± 0.45
BMI (kg/m2) 6.12 ± 0.12 5.84 ± 0.10
Cortisol (μg/L) 2.92 ± 0.45 2.51 ± 0.59
TG (mg/dL) 131.8 ± 5.5 131.0 ± 4.7
TC (mg/dL) 121.8 ±6.7 118.25±7.30
FFA (μg/L) 567 ± 65 469 ±31.5
Glucose (mg/dL) 137.13 ± 10.40 133.63 ±8.9
Gastrocnemius Glycogen(mg/g) 43.02 ± 4.10 33.77 ± 3.01
Liver Glycogen (mg/g) 79.42 ± 10.55 92.85 ± 8.94

 

Resting plasma ghrelin was non-significantly higher in the trained group, when compared to controls (18.55±3.92 pg/m1 vs. 12.51±1.80pg/mL) (Fig.3). In contrast to plasma, resting fundus ghrelin concentration was significantly (P=0.039) lower in trained rats, when compared to the untrained group (9.24±2.47pg/mL vs. 20.67±4.20pg/mL) (Fig.3).

 

Fig.3. Fundus (A) and plasma (B) acylated ghrelin concentrations in control and trained wild type male rats, n=10 animals each. Data is expressed as Mean±SEM, *trained vs. control, P=0.03.

 

 

Fig.4. Plasma GH (A) and insulin (B) concentrations in control and trained wild type male rats

Changes in resting plasma glucose, and cortisol were not significant (Table.1). Resting plasma GH and insulin concentrations were non-significantly higher (approx 1.33 and 2.408 fold, respectively) in trained rats when compared to the control group (P=0.41, P=0.214, respectively) (Fig. 4).Plasma triglyceride (TG), total Cholesterol (TC), and free fatty acid (FFA)Plasma TG remained unchanged. Total cholesterol concentration was non-significantly lower in trained rats. A considerable reduction of plasma FFA did not reach significant level in trained rats (Table 1).Liver and muscle glycogen concentrations Resting liver and whole gastrocnemius muscle glycogen concentrations were non-significantly higher (92.85±8.94 vs. 79.42±10.55mg/g wet tissue) and lower (33.77±3.01 vs. 43.02±4.15mg/g wet tissue) respectively, in trained rats when compared with controls (Table 1). There were no significant correlations between plasma acylated ghrelin and variables measured (Table 2).

 

Table 2. Baseline Pearson correlation coefficients of acylated ghrelin levels with body weight, BMI, fundus acylated ghrelin, lipid profile, hormones, liver and muscle glycogen concentrations in wild type male rats.

Variables Correlation with
plasma ghrelin
P values
Weight (g) - 0.056 0.836
MBI (kg/m2) 0.129 0.633
Fundus acylated ghrelin (pg/mL) - 0.070 0.819
Glucose (mg/dL) 0.483 0.068
TG (mg/dL) - 0.075 0.781
TC (mg/dL) - 0.023 0.934
FFA (μg/L) - 0.107 0.703
GH (ng/mL) - 0.256 0.338
Insulin (μg/L) - 0.108 0.690
Cortisol (μg/mL) 0.151 0.576
Gastrocnemius glycogen (mg/g) -0.061 0.842
Liver glycogen (mg/g) 0.493 0.134

 

Discussion

The major findings of the present study were a significantly higher ghrelin expression by fasting, a lower ghrelin expression and fundus acylated ghrelin by treadmill exercise. Correlations between plasma ghrelin and plasma glucose concentration and between fundus ghrelin and TG were other important findings. However a non-significant and higher plasma acylated gGhrelin, GH and Insulin were obtained. Fasting for different durations (18, 24, 48, 72 hours, and 7days) is also known to be associated with increased plasma ghrelin concentrations and expression of ghrelin in the gastrointestinal tract, mainly gastric and particularly in the fundus26-28 . According to Ghelardoni et al.29, fasting did not result in a major changes in stomach ghrelin mRNA expression, but ghrelin protein concentration in tissue was significantly modified in fasted rats; they suggested that while ghrelin concentrations were increased in most tissues, they were decreased in the stomach, accompanied with an increase in plasma ghrelin concentration in fasted rats. Data on the effect of treadmill exercise on ghrelin mRNA expression and acylated ghrelin levels in wild rats’ fundus are lacking. The present study, for the first time, showed that, resting ghrelin mRNA expression and its levels in rat fundus decrease, following the 8 weeks of treadmill exercise training. The mechanism(s) by which treadmill exercise reduces fundus ghrelin concentrations is poorly understood. However, it is believed that the synthesis and release of ghrelin from the gastrointestinal tract, particularly the stomach as a main source, and the splanchenic bed, as a minor source of circulating ghrelin, could be regulated by nutrients and hormones, such as insulin, GH, glucagon, and glucagon-like peptide30-37. Exercise is a known stimulant of growth hormone secretion and the magnitude of elevation has been found to be related to both the duration and intensity of the exercise38,39. Increases in growth hormone levels after endurance exercise have been well documented40-43. In the present study trained rats had higher and nonsignificant resting plasma GH (1.36 fold) and insulin(2.24 fold) concentrations. Actually, we do not know that how much change of the endogenous GH and insulin are required to inhibit ghrelin secretion from stomach. In this study we did not measure glucagon-like peptide-1 (GLP-1), but, it is believed that ghrelin secretion for stomach could be inhibited by GLP-1 which is released from intestinal L-cell. O'Connor et al38. suggested that running on a treadmill for 2 h at 60% VO2 max significantly increased gastrin, and glucagon-like peptide-1 (GLP-1). Martines et al39. has reported that 60 minutes of cycling at intensity of 64-68.5% heart rate maximum significantly increased mean PYY, GLP-1, and pancreatic polypeptide (PP) during exercise and this increase was maintained during the post-exercise period for GLP-1 and PP. In addition to hormonal regulation of ghrelin, it is believed that cholinergic (acetylcholine) and sympathetic system plays an important role in ghrelin secretion from gastrointestinal tract40-42 . Mundinger et al.43 observed that the electrical stimulation of postganglionic sympathetic axon projecting from the celiac ganglion and using a sympathomimic drug (Tyramine, TYR) raised portal ghrelin concentrations in rats. On the other hand, gastric/intestinal electrical stimuli for systemic release of hormone, gut peptides secretion, plasma glucose, and food intake by previous studies44-46. In study by Xing et al.45 long-pulse (300 msec) electrical stimulation showed that the total AUCs of plasma ghrelin was not significantly affected but after 2hours of an electrical stimulation on gastric (GES) ( long pulse-with pulse trains) and duodenal electrical stimulation (DES) (with pulse trains) significantly and dramatically decreased fundus ghrelin. An endurance-exercise induced adaptations on different body systems and organs; particularly on gastrointestinal has been studied by several investigators 45-48. A lower ghrelin mRNA expression and fundus acylated ghrelin and a higher plasma acylated ghrelin levels could be attributed to metabolic changes (liver and muscle glycogen and ATP depletion are less in endurance trained species ) and might be due to an incomplete energy source recovery in trained and overnight fast rats. A higher plasma acylated ghrelin in the present study might be attributed to a liver and skeletal muscle glycogen and ATP deficiency and an incomplete recovery of energy sources after the last exercise session. In the present experiment conditions resting liver and whole gastrocnemius muscle glycogen conce-ntrations were nonsignificantly higher and lower in trained rats, respectively. Although, a limitation of the study with regard to this finding is that total ghrelin concentrations were not measured, but an increase in fundus acylated ghrelin catabolism and conversion to other forms of ghrelin and also a reduction in stomach and fundus ghrelin-expressing cell dense cannot be excluded. To our knowledge, the present study is the first to examine the resting plasma acylated ghrelin concentrations after 8 weeks of treadmill exercise training in rats. However several previous studies the response of plasma total ghrelin to exercise training program in human13 and horse14-15 have investigated. In study by Tschop et al.26 in rats were subjected to an acute treadmill running (22m/min, 10% slope) resulted in a significant increase in plasma total ghrelin level which was accompanied with a significant reduction in liver and gastrocnemius (white and red) muscle glycogen contents. In study by Ebal et al.17 a 5 weeks of force-resistance exercise resulted in a significant reduction in plasma total Ghrelin concentrations in fed rats. The discrepancies between our results with previous reported results could be explained by subjects (human vs. rats), duration of exercise training program (8 weeks vs. 5 weeks), mode of exercise training (treadmill running vs. force-resistance exercise), and nutritional status (overnight fast vs. fed condition). It seems that higher resting plasma ghrelin in trained rats might be due to an incomplete recovery of energy sources which become depleted during the last session of treadmill exercise which was combined with an overnight fast state in rats49-55. A lower muscle glycogen as we observed in the present study might be considered as a stimulus for this elevated plasma acylated in trained rats. Despite treadmill-exercise induced reduction in fundus acylated ghrelin, this elevated plasma acylated ghrelin level might be due to an increase in ghrelin secretion from extra-gastric tissue such as splanchenic beds55,56 and peripheral blood lymphocytes (our unpublished data). This is the first report demonstrating that resting fundus ghrelin expression and its acylated ghrelin lower in trained rats. The present study also for the first time provides information about resting plasma acylated ghrelin in wild type male rats.In summary, the data indicate that a treadmill-exercise induced decrease in fundus ghrelin expression was accompanied with a reduction in fundus acylated ghrelin, but not in plasma acylated ghrelin. The results also indicate that an overnight fasting-induced deficiency in muscle and liver energy status might be considered as a factor in ghrelin regulation. It seems that the effect of treadmill exercise training on ghrelin was somewhat masked by overnight fast period. A higher resting plasma acylated ghrelin level in trained rats in partly confirms the secretion of ghrelin from the other sources. It can also be concluded that treadmill-exercise training was able to modulate this orexigenic peptide.

Ghrelin, a 28-amino acid peptide recently isolated from the human and rat stomach, is also present in human and rat pancreatic alpha-cells1, 2. It is also recognized as a novel player in the gut-brain regulation of growth hormone and energy balance3. The molecule has been shown to be a growth hormone (GH) secretagogue that stimulates an increase in blood glucose4,5. Ghrelin has a potent effect on eating behavior, causing an increase in hunger2 and plays a key role in the central regulation of feeding6. It has been suggested that the stomach is a major source of circulating ghrelin in humans7. Interestingly, ghrelin levels are significantly altered during acute and chronic aberration in nutritional status. Thus ghrelin levels are low in simple obesity but increase after weight loss8,9. Ghrelin is up-regulated by fasting, insulin-induced hypoglycemia and leptin administration10,11. Plasma Ghrelin response to different kind of physical exercise has been studied by several investigators in human12,13, horse14,15, and rat subjects16,17. The results are conflicting, several studies documenting no change in plasma ghrelin concentration, while others observed suppressed levels. To date, most investigations have focused on plasma ghrelin response to an acute exercise (shortterm, or long-term, resistance or aerobic exercise). Foster-Schubert et al studied the effect of an aerobic exercise for 12 months on 173 sedentary, overweight, postmenopausal women, and reported that plasma ghrelin increases by 18% in exercisers who lost over 3 kg of weight13. Ebal et al17 studied the effect of 5 weeks of a force-resistance exercise on plasma ghrelin concentration in rats, and suggested that training reduced the rats’ body weight by 6.4% and lowered ghrelin levels. Recent evidence suggests that skeletal muscle is an important site of ghrelin action. Ghrelin and growth hormone secretagogue receptor (GHS-R) have been found in skeletal muscle18 and it has been shown that growth hormone secretagogue can alter both electrical and contractile activity in skeletal muscle19. Moreover, GHS receptors have been localized in skeletal muscle20. Collectively, these studies suggest that the fundus as well as skeletal muscle is important sites of ghrelin action.

Treadmill running speeds have been used previously to elicit the respective moderate VO2 max values (%) for Wistar rats21 and previous data from our lab suggest that training, 25m/min, 60 min/day, 5days/week for 6 weeks affected total ghrelin levels in rat soleus muscle22; Hence we utilized a reasonable training time period to produce the expected acylated ghrelin adaptations. However, there is no information about the effects of treadmill exercise (8 weeks) at moderate intensity (28 m/min, 0% grade) on fundus ghrelin expression, fundus and plasma ghrelin concentration in wild type male rats. This study was therefore conducted to determine the effect of treadmill exercise on resting fundus ghrelin expression, fundus plasma ghrelin concentrations and glucoregulatory hormones.

References: (56)

  1. Kojima M, Hosoda H, Date Y, Nakazalo M, Matsuo H, Kanggawa K. Ghrelin is a growth hormone releasing acylated peptide from stomach. Nature 1999; 402: 656-60.
  2. Date Y, Nakazato M, Hashiguchi S, Dezaki K, Mondal MS, Hosoda H, et al. Ghrelin is present in pancreatic alpha-cells of human and rat stimulate insulin secretion. Diabetes 2002; 51: 124-9.
  3. St-Pierre DH, Wang L, Tache Y. Ghrelin: a novel player in the gut–brain regulation of growth hormone and energy balance. News Physiol Sci 2003;18: 242-6.
  4. Arosio M, Ronchi CL, Gebbia C, Cappiello V, Beck-Peccoz P, Peracchi M, et al. Stimulatory effect of Ghrelin on circulating somatostatin and pancreatic polypeptide. J Clin Endocrinol Metab 2003; 88: 701-4.
  5. Broglio F, Arvat E, Benso A, Gottero C, Muccioli G, Papotti M, et al. Ghrelin, a natural GH secretagogue produced by the stomach, induces hyperglycemia and reduces insulin secretion in human. J Clin Endocrinol Metab 2001; 86: 5083-6.
  6. Nakazato M, Murakami N, Date Y, Kojima M, Matsuo H, Kangawa K, et al. A role for Ghrelin in the central regulation of feeding. Nature 2001;409: 194-8.
  7. Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T, et al. Stomach is a major source of circulating Ghrelin, and feeding state determines plasma Ghrelin-like immunoreactivity levels in human. J Clin Endocrinol Metab 2001; 86: 4753-8.
  8. Hansen TK, Dall R, Hosoda H, Kojima M, Kangawa K, Christiansen JS, et al. Weight loss increases circulating levels of Ghrelin in human obesity. Clin Endocrinol 2002; 56: 203-6.
  9. Espelund U, Hansen TK, Højlund K, Beck-Nielsen H, Clausen JT, Hansen BS, et al. Fasting unmasks a strong inverse association between Ghrelin and cortisol in serum: studies in obese andnormal-weight subjects. J Clin Endocrinol Metab 2005; 90: 741-6.
  10. Toshinai K, Mondal MS, Nakazato M, Date Y, Murakami N, Kojima M, et al. Upregulation of Ghrelin expression in the stomach upon fasting insulin-induced hypoglycemia and leptin administration. Biochem Biophys Res Commun 2001; 281: 1220-5.
  11. Knerr I, Gröschl M, Rascher W, Rauh M. Endocrine effect of food intake: insulin, Ghrelin, and leptin responses to a single bolus of essential amino acids in humans. Ann Nutr Metab 2003; 47: 312-8.
  12. Erdmann J, Tahbaz R, Lippl F, Wagenpfeil S, Schusdziarra V. Plasma Ghrelin levels during exercise - Effects of intensity and duration. Regul Pept 2007; 4: 127-35.
  13. Foster-Schubert KE, McTiernan A, Frayo RS, Schwartz RS, Rajan KB, Yasui Y, et al. Human plasma Ghrelin levels increase during a one-year exercise program. J Clin Endocrinol Metab 2005;90: 820-5.
  14. Gordon ME, McKeever KH, Betros CL, Manso Filho HC. Exercise-induced alterations in plasma concentrations of Ghrelin, adiponectin, leptin, glucose, insulin, and cortisol in horses. Vet J 2007;173: 532-40.
  15. Gordon ME, McKeever KH, Betros CL, Manso Filho HC. Plasma leptin, Ghrelin and adiponectin concentrations in young fit racehorses versus mature unfit standardbreds.Vet J 2007; 173: 91-100.
  16. Andersson U, Treebak JT, Nielsen JN, Smith KL, Abbott CR, Small CJ, et al. Exercise in rats does not alter hypothalamic AMP-activated protein kinase activity. Biochem Biophys Res Commun 2005; 329: 719-25.
  17. Ebal E, Cavalie H, Michaux O, Lac G. Effect of a moderate exercise on the regulatory hormones of food intake in rats. Appetite 2007; 49: 529-34
  18. Gnanapavan S, Kola B, Bustin SA, Morris DG, McGee P, Fairclough P, et al. The tissue distribu-tion of the mRNA of ghrelin and subtypes of its receptor, GHS-R, in humans. J Clin Endocrinol Metab 2002; 87: 2988.
  19. Pierno S, De Luca A, Desaphy JF, Fraysse B, Liantonio A, Didonna MP, et al. Growth hormone secretagogues modulate the electrical and contractile properties of rat skeletal muscle through a ghrelin-specific receptor. Br J Pharmacol 2003;139: 575-84.
  20. Papotti M, Cassoni P, Volante M, Deghenghi R, Muccioli G, Ghigo E. Ghrelin-producing endocrine tumors of the stomach and intestine. J Clin Endocrinol Metab 2001; 86: 5052-9.
  21. Ghanbari-Niaki A. Ghrelin and glucoregulatory hormone responses to a single circuit resistance exercise in male college students. Clin Biochem 2006; 39: 966-70.
  22. Ghanbari-Niaki A, Soltani R, Shemshaki A, Kraemer RR. Effects of acute ethionine injection on plasma ghrelin and obestatin levels in trained male rats. Metabolism 2010; 59: 982-7.
  23. Powers SK, Criswell D, Lawler J, Martin D, Lieu FK, Ji LL, et al. Rigorous exercise training increase superoxide dismutase activity in ventricular myocardium. Am J Physiol 1993; 265: H2094-8.
  24. Thirunavukkarasu V, Balakrishnan SD, Ravichandran MK, Anuradha CV. Influence of 6-week exercise training on erythrocyte and liver antioxidant defense in hyperinsulinemic rats. Comp Biochem Physiol C Toxicol Pharmacol 2003; 135: 31-7.
  25. Chomczynski P, Sacchif N. Single-step method of RNA isolation by acid guanidinium thiocyanatephenol-chloroform extraction. Anal Biochem 1987; 162: 156-9.
  26. Tschop M, Smiley DL, Helman ML. Ghrelin induces adiposity in rodents. Nature 2000; 407: 908–13.
  27. Moesgaard SG, Ahren B, Carr RD, Gram DX, Brand CL, Sundler F. Effects of high-fat feeding and fasting on Ghrelin expression in the mouse stomach. Regul Pept 2004; 120: 261-7.
  28. Govoni N, Deiasio R, Cocco C, Parmeggiani A, Galeati G, Pagotto U, et al. immune localization and plasma profiles of acyl-Ghrelin in fasted and fasted-refed prepuberal gilts. J Endocrinol 2005;186: 505–13.
  29. Ghelardoni S, Carnicelli V, Frascarelli S, Roca-Testoni S, Zucchi R. Ghrelin tissue distribution: comparison between gene and protein expression. J Endocrinol Invest 2006; 29: 115-21.
  30. Sönmez MF, Ozan E. Determination of ghrelin immunoreactivity in the rat stomach after fasting and refeeding. Acta Histochem 2007; 109: 193-9
  31. Zizzari P, Longchamps R, Epelbaum J, Bluet-Pajot MT. Obestatin partially affects Ghrelin stimulation of food intake and growth hormone secretion in rodents. Endocrinology 2007; 148: 1648-53.
  32. Kojima M, Kangawa K. Ghrelin: Structure and Function. Physiol Rev 2005; 85: 495-522.
  33. Broglio F, Gottero C, Prodam F, Destefanis S, Gauna C, Me E, et al. Ghrelin secretion is inhibited by glucose load and insulin-induced hypoglycaemia but unaffected by glucagon and arginine in humans. Clin Endocrinol 2004; 61: 503-9.
  34. Felsing NE, Brasel J, Cooper DM. Effect of low and high intensity exercise on circulating growth hormone in men. J Clin Endocrinol Metab 1992;75: 157-62.
  35. Godfrey RJ, Madgwick Z, Whyte GP. The Exercise-Induced Growth Hormone Response in Athletes. Sports Med 2003; 33: 599-613.
  36. Weltman A, Weltman JY, Schurrer R, Evans WS, Veldhuis JD, Rogol AD. Endurance training amplifies the pulsatile release of growth hormone: effects of training intensity. J Appl Physiol 1992;76: 2188-96.
  37. Consitt LA, Copel, JL, Tremblay MS. Endogenous Anabolic Hormone Responses to Endurance Versus Resistance Exercise and Training in Women. Sports Med 2002; 32 : 1-22.
  38. O'Connor AM, Pola S, Ward BM, Fillmore D, Buchanan KD, Kirwan JP. The gastroenteroinsular response to glucose ingestion during post exercise recovery. Am J Physiol Endocrinol Metab 2006;290: E1155-61.
  39. Martins C, Morgan LM, Bloom SR, Robertson MD. Effects of exercise on gut peptides, energy intake and appetite. J Endocrinol 2007; 193: 2518.
  40. Broglio F, Gottero C, Van Koetsveld P, Prodam F, Benso A, Gauna C, et al. Acetylcholine Regulates Ghrelin Secretion in Humans J Clin Endocrinol Metab 2004; 89: 2429-33.
  41. Sugino T, Yamaura J, Yamagishi M, Kurose Y, Kojima M, Kangawa K, et al. Involvement of cholinergic neurons in the regulation of the Ghrelin secretory response to feeding in sheep. Biochem Biophys Res Commun 2003; 304: 308-12.
  42. Williams DL, Grill HJ, Cummings DE, Kaplan JM. Vagotomy dissociates short- and long-term controls of circulating Ghrelin. Endocrinology 2003; 144: 5184-7.
  43. Mundinger TO, Cummings DE, Gerald J, Taborsky Jr. Direct Stimulation of Ghrelin Secretion by Sympathetic Nerves. Endocrinology 2006; 147: 2893-2901.
  44. Xu J, McNearney TA, Chen JD. Gastric/intestinal electrical stimulation modulates appetite regulatory peptide hormones in the stomach and duodenum in rats. Obes Surg 2007; 17: 406-13.
  45. Xing JH, Lei Y, Ancha HR, Harty RF, Chen JD. Effect of acute gastric electrical stimulation on the systemic release of hormones and plasma glucose in dogs. Dig Dis Sci 2007; 52: 495-501.
  46. Ouyang H, Chen JD. Long-pulse gastric electrical stimulation at tachygastrial frequency reduces food intake by inhibiting proximal gastric tone. Scand J Gastroenterol 2007; 42: 702-7.
  47. Holloszy JO. Biochemical adaptations to exercise: aerobic metabolism. Exerc Sport Sci Rev 1973; 1: 45-71.
  48. Fitts RH, Booth FW, Winder WW, Holloszy JO. Skeletal muscle respiratory capacity, endurance, and glycogen utilization. Am J Physiol 1975; 228: 1029-33.
  49. Ghanbari-Niaki A, Bergeron R, Latour MG, Lavoie JM. Effects of physical exercise on liver ATP in fasted and phosphate-injected rats. Arch Physiol Biochem 1999; 107: 393-402.
  50. Ghanbari-Niaki A, Desy F, Lavoie JM. Effects of phosphate injection on metabolic and hormonal responses to exercise in fructose-injected rats. Physiol Behav 1999; 67: 747-52.
  51. Ghanbari-Niaki A, Desy F, Lavoie JM. Effects of acute ethionine-induced hepatic deficiency at rest and during exercise in female rats. Facta Univ: Phys Educ Sport 2005; 3: 11-22.
  52. Huijing F. A rapid enzymatic method for glycogen estimation in very small tissue samples. Clin Chim Acta 1970; 30: 567-3.
  53. Baldwin KM, Fitts RH, Booth FW, Winder WW, Holloszy JO. Depletion of muscle and liver glycogen during exercise: protective effects of training. Pflugers Arch 1975; 354: 203-12.
  54. Devriese C, Gregoire F, Lema-Kisoka R, Waelbroeck M, Robberecht P. Ghrelin Degradation by Serum and Tissue Homogenates: Identification of the Cleavage Sites. Endocrinology 2004; 145: 4997–5005.
  55. Gualillo O, Lago F, Gomez-Reino J, Casanueva FF, Dieguez C. Ghrelin, a widespread hormone: insights into molecular and cellular regulation of its expression and mechanism of action. FEBS Lett 2003; 552: 105-9.
  56. Hattori N, Saito T, Yagyu T, Jiang BH, Kitagawa K, Inagaki C. GH, GH receptor, GH secretagogue receptor, and ghrelin expression in human T cells, B cells, and neutrophils. J Clin Endocrinol Metab 2001; 86:4284–91.